emlsa.net Report : Visit Site

Technical data of the emlsa.net

Geo IP provides you such as latitude, longitude and ISP (Internet Service Provider) etc. informations. Our GeoIP service found where is host emlsa.net. Currently, hosted in United Kingdom and its service provider is Imperial College London .

HTTP Header Analysis

HTTP Header information is a part of HTTP protocol that a user's browser sends to called Microsoft-IIS/7.5 containing the details of what the browser wants and will accept back from the web server.

DNS

HtmlToText

home instructions databases viridans group streptococci burkholderia spp. -- please note: we are currently upgrading our servers and there may be some disruption to service prior to 26th july - apologies for inconvenience assigning bacterial strains to species via the internet – electronic taxonomy www..net provides a portal for the electronic taxonomy of bacteria, providing a common format and software for assigning strains to species via the internet. electronic taxonomy contrasts with the current approach for distinguishing species within a genus, and for defining new species, which is based on polyphasic taxonomy, an approach that incorporates all available phenotypic and genotypic data into a consensus classification (vandamme et al., 1996). for further information and instructions please see the instruction pages. software requirements browser: java: if you experience problems using the site please see the troubleshooting guide here. introduction. primers, pcr conditions and sequence trimming. entering your sequences. reference tree view. collapsing nodes. locus view. database query. downloading data. submission of strains. system requirements. acknowledgements. references. introduction .net provides a portal for the electronic taxonomy of bacteria, providing a common format and software for assigning strains to species via the internet. electronic taxonomy contrasts with the current approach for distinguishing species within a genus, and for defining new species, which is based on polyphasic taxonomy, an approach that incorporates all available phenotypic and genotypic data into a consensus classification (vandamme et al ., 1996). the accepted genotypic method for defining species is based on overall genomic relatedness, such that strains which share approximately 70% of more relatedness using dna-dna hybridization, under standard conditions, are considered to be members of the same species (wayne et al ., 1987). in recent years there has been an interest in improving the way molecular data are used to help define species. in particular, there has been a move away from the cumbersome dna-dna hybridization procedure and fixed or semi-fixed cut-off values for defining species, and an increased interest in other molecular approaches to identifying and circumscribing bacterial species (stackebrandt et al ., 2002). one newer approach is to observe the distribution of a large number of strains of closely related species in sequence space and to identify clusters of strains that are well resolved from other clusters. this approach has been developed by using the concatenated sequences of multiple core (house-keeping) genes to assess clustering patterns, and has been called multilocus sequence analysis (mlsa; gevers et al ., 2005; hanage et al ., 2006), or multilocus sequence phylogenetic analysis (nørskov-lauritsen et al. ,2005). mlsa has been used successfully to explore clustering patterns among large numbers of strains assigned to very closely-related species by current taxonomic methods (godoy et al ., 2003; hanage et al ., 2005a,b, 2006; hoshino et al ., 2005, bennett et al ., 2007; kilian et al ., 2008; bishop et al ., submitted), to look at the relationships between small numbers of strains within a genus (martens et al ., 2008), or within a broader taxonomic grouping (sawabe et al ., 2007), and to address specific taxonomic questions (postic et al ., 2007; thompson et al . 2007). more generally, mlsa can be used to ask whether bacterial species exist – that is, to observe whether large populations of similar strains invariably fall into well resolved clusters, or whether in some cases there is a genetic continuum in which clear separation into clusters is not observed. is the implementation of the mlsa approach to the assignment of strains to species clusters via the internet. requires the generation of a large database of the sequences of the multiple house-keeping loci (typically about seven loci) from multiple strains of a set of related species of interest. it also requires software that can concatenate the sequences and produce a tree, which shows the patterns of clustering of the sequences. by comparing the species assignments of the strains within each sequence cluster, including the position of the type strain of each species, the sequence clusters can be assigned as species clusters. having generated a database and assigned the species clusters, the sequences of the multiple loci of a query strain are submitted to the relevant .net subsite and the position of the strain on the reference tree is returned, with the species assignment. additional software at .net allows the most similar concatenated sequences in the database(and the species assigned to these closest matches) to be returned and for the source of each allele to be assigned as resident to that species or possibly imported from a related species. microbiologists are encouraged to submit new strains, and the corresponding sequences, to the curator at .net as this expands the database, but also has the potential to identify new sequence clusters, which may be assigned as new species. our view is that electronic taxonomy, as implemented at .net, provides a way of assigning strains to species that is at least as valid as other methods. at the very least it provides a hypothesis about the relationships between sequence clusters generated using core genes and species clusters that can be tested, revised or refuted by the addition of phenotypic, genotypic or ecological data. at present, .net databases are available for viridans group streptococci, a group where species assignment by more traditional means is problematic, for burkholderia pseudomallei and related species, and for borrelia species. please contact david aanensen (d.aanesen[at]imperial.ac.uk) if you wish to host a mlsa subsite at .net. primers, pcr conditions and sequence trimming primer gene product sequence (5'-3') * primer length (bp) trimmed fragment size (bp) annealing temperature ( o c) map -up map -dn methionine aminopeptidase gcwgactcwtgttgggcwtatgc ttartaagttcyttcttcdccttg 23 24 348 55 55 pfl -up pfl -dn pyruvate formate lysase aacgttgcttactctaaacaaactgg acttcrtggaagacacgttgwgtc 26 24 351 55 55 ppac -up ppac -dn inorganic pyrophosphatase gaccayaatgaattycarcaatc tgaggnacmacttgtttsttacg 23 23 552 50 50 pyk -up pyk -dn pyruvate kinase gcggtwgaawtccgtggtg gcaagwgctgggaaaggaat 19 20 492 50 50 rpob -up rpob -dn rna polymerase beta subunit aarytiggmcctgaagaaat tgiartttrtcatcaaccatgtg 20 22 516 50 50 soda -up soda -dn superoxide dismutase trcaycatgayaarcaccat arrtartamgcrtgytcccaracrtc 20 26 378 50 50 tuf -up tuf -dn elongation factor tu gttgaaatggaaatccgtgacc gttgaagaatggagtgtgacg 22 21 426 55 55 * sequences are shown using the iupac codes for sites where degeneracy was introduced. to view a single example of each sequence please click the following links - coming shortly!!! entering your sequences after choosing the database from the links on the left hand side of the page, you will be presented with a form consisting of a number of text boxes corresponding to the loci used for mlsa within the species group. the gene name can be seen above each textbox. paste each trimmed sequences into the corresponding textbox as one continuous string (ie including no spaces.) error messages are returned should your sequence contain any non-dna characters or be of incorrect length for that locus. once all seven sequences are entered correctly, the borders of the textboxes will turn green indicating that the sequences are correctly entered. should the genome sequences be available for strains of some species within a species group, a checkbox is present which, when checked, will include the concatenated sequences from these genomes when producing the reference tree. by default genome sequences are not included in the reference tree. click ‘submit’ to proceed. click ‘click to view tree’ which will take you to the tree view page.

URL analysis for emlsa.net

http://www.emlsa.net/#database
http://www.emlsa.net/#introduction
http://www.emlsa.net/#acknowledgements
http://www.emlsa.net/#locus
http://www.emlsa.net/#refs
http://www.emlsa.net/#primers
http://www.emlsa.net/#downloading
http://www.emlsa.net/#instructions
http://www.emlsa.net/#requirements
http://www.emlsa.net/#instructions
http://www.emlsa.net/#treeview
http://www.emlsa.net/#submitting
http://www.emlsa.net/#pasting
http://www.emlsa.net/#home
http://www.emlsa.net/#collapsing
wellcome.ac.uk
imperial.ac.uk

Whois Information

Whois is a protocol that is access to registering information. You can reach when the website was registered, when it will be expire, what is contact details of the site with the following informations. In a nutshell, it includes these informations;

Domain Name: EMLSA.NET
Registry Domain ID: 1510254604_DOMAIN_NET-VRSN
Registrar WHOIS Server: whois.wildwestdomains.com
Registrar URL: http://www.wildwestdomains.com
Updated Date: 2017-07-26T16:59:28Z
Creation Date: 2008-07-25T07:18:01Z
Registry Expiry Date: 2019-07-25T07:18:01Z
Registrar: Wild West Domains, LLC
Registrar IANA ID: 440
Registrar Abuse Contact Email: [email protected]
Registrar Abuse Contact Phone: 480-624-2505
Domain Status: clientDeleteProhibited https://icann.org/epp#clientDeleteProhibited
Domain Status: clientRenewProhibited https://icann.org/epp#clientRenewProhibited
Domain Status: clientTransferProhibited https://icann.org/epp#clientTransferProhibited
Domain Status: clientUpdateProhibited https://icann.org/epp#clientUpdateProhibited
Name Server: MONOLITH.CC.IC.AC.UK
Name Server: NS1.IC.AC.UK
DNSSEC: unsigned
URL of the ICANN Whois Inaccuracy Complaint Form: https://www.icann.org/wicf/
>>> Last update of whois database: 2017-09-01T01:29:50Z <<<

For more information on Whois status codes, please visit https://icann.org/epp

NOTICE: The expiration date displayed in this record is the date the
registrar's sponsorship of the domain name registration in the registry is
currently set to expire. This date does not necessarily reflect the expiration
date of the domain name registrant's agreement with the sponsoring
registrar. Users may consult the sponsoring registrar's Whois database to
view the registrar's reported date of expiration for this registration.

TERMS OF USE: You are not authorized to access or query our Whois
database through the use of electronic processes that are high-volume and
automated except as reasonably necessary to register domain names or
modify existing registrations; the Data in VeriSign Global Registry
Services' ("VeriSign") Whois database is provided by VeriSign for
information purposes only, and to assist persons in obtaining information
about or related to a domain name registration record. VeriSign does not
guarantee its accuracy. By submitting a Whois query, you agree to abide
by the following terms of use: You agree that you may use this Data only
for lawful purposes and that under no circumstances will you use this Data
to: (1) allow, enable, or otherwise support the transmission of mass
unsolicited, commercial advertising or solicitations via e-mail, telephone,
or facsimile; or (2) enable high volume, automated, electronic processes
that apply to VeriSign (or its computer systems). The compilation,
repackaging, dissemination or other use of this Data is expressly
prohibited without the prior written consent of VeriSign. You agree not to
use electronic processes that are automated and high-volume to access or
query the Whois database except as reasonably necessary to register
domain names or modify existing registrations. VeriSign reserves the right
to restrict your access to the Whois database in its sole discretion to ensure
operational stability. VeriSign may restrict or terminate your access to the
Whois database for failure to abide by these terms of use. VeriSign
reserves the right to modify these terms at any time.

The Registry database contains ONLY .COM, .NET, .EDU domains and
Registrars.

  REGISTRAR Wild West Domains, LLC

SERVERS

  SERVER net.whois-servers.net

  ARGS domain =emlsa.net

  PORT 43

  TYPE domain

DOMAIN

  NAME emlsa.net

  CHANGED 2017-07-26

  CREATED 2008-07-25

STATUS
clientDeleteProhibited https://icann.org/epp#clientDeleteProhibited
clientRenewProhibited https://icann.org/epp#clientRenewProhibited
clientTransferProhibited https://icann.org/epp#clientTransferProhibited
clientUpdateProhibited https://icann.org/epp#clientUpdateProhibited

NSERVER

  MONOLITH.CC.IC.AC.UK 155.198.142.108

  NS1.IC.AC.UK 155.198.142.81

  REGISTERED yes

Mistakes

The following list shows you to spelling mistakes possible of the internet users for the website searched .